2. A chromosome is________________. A. A huge structure consisted of of protein
B. Made entirely of DNA
C. Proteins wrapped approximately DNA molecule
D. DNA organized roughly proteins
3. I m sorry of the adhering to statements is false?
A. A eukaryotic bio cell’s chromosomal DNA is housed in a solitary compartment dubbed the nucleus.
B. Every one of a cell’s chromosomal DNA is organized right into a solitary unit referred to as the chromosome.
C. Chromosomal DNA replication takes place only in the nucleus.
You are watching: If the sequence of one strand of dna is agtctagc, what is the sequence of the complementary strand?
D. Chromosomal DNA is wound around proteins.
4. The building block of DNA is _______?
A. The nucleotide
B. The amino acid
C. Glucose
D. Phosopholipid
5. DNA deserve to be used to determine a specific person because__________________.
A. DNA have the right to be visualized under a microscope and then compared to recognized samples.
B. Each person has actually a different variety of chromosomes.
C. The chemistry that make up DNA are various from human being to person.
D. The specific sequence the nucleotides is different from person to person .6. In a DNA molecule, the base A always pairs with _____ and also G always pairs through _____.
A. T, C
B. U, C
C. U, T
D. C, T
E. C, U
7. If 26% the the bases in a piece of double-stranded DNA is G, what percent that the bases room T in that very same DNA piece?
A. 13%
B. 24%
C. 26%
D. 48%8. “DNA replication is semi-conservative.” What go this declare mean?
A. Each recently made DNA molecule has one original and also one brand-new strand of DNA.
B. Each freshly made DNA molecule is do of only new strands of DNA.
C. Each newly made DNA molecule is do of only old initial strands that DNA
9. The sugar in DNA is: A. A 4 carbon ribose B. Sucrose C. A 5 carbon ribose D. A 5 carbon deoxyribose
10. Which of the complying with statement many accurately defines the function of PCR?
A. PCR causes cells come replicate their DNA, producing large quantities that chromosomal DNA.
B. All the DNA in a provided sample is copied to develop a large quantity.
C. Large amounts of RNA are produced from a small sample that DNA.
D. It is a way to physically eliminate the very tiny amounts the DNA the are existing in a organic sample.
E. A particular sequence that DNA is replicated over and over again until a huge quantity is produced.
E
11. I m sorry of the complying with statements is true?
A. Non-coding regions of DNA have no recognized function.
B. STRs are discovered in coding areas of the DNA.
C. No two people can have the exact same STR sequences at two various sites.
D. DNA proof can prove v 100% accuracy that someone committed a crime.
E. Every one of the over are false.
E
12. Put the adhering to steps affiliated in developing a DNA file in the correct order: A. Amplify DNA assignment B. Extract DNA native a sample C. Separate DNA by size 1. A, B, C 2. B, A, C 3. C, A, B 4. A, C, B 5. B, C, A
2
13. Gel electrophoresis off DNA molecule by loved one ________. _______ fragments of DNA run towards the bottom the the gel.
A. Charge; positively charged
B. Sequence; exactly
C. Size; Smaller
D. Electricity; Large
C
14. Here are non-coding sequences native Mary and Bob. Both assignment come indigenous the same region of chromosome 12: Mary: TTCGTTCCTAGCTAGCTAGCTAGCTAGCTTAACCGGC Bob: TTCGTTCCTAGCTAGCTTAACCGGC which of the adhering to accurately to compare Mary and Bob’s DNA? A. Mary has five STRs at the site; Bob has two. B. Mary has actually one STR at this site; Bob has none
A
15. I beg your pardon of the following would provide the greatest chance of identifying a human using a DNA profile? A. 5 mrs sites B. 15 woman sites C. 25 mrs sites D. There’s no difference.
C
16. What is intended by the “genome”?
A. A single chromosome in a human cell
B. One complete collection of human chromosomes
C. Coding DNA in a cell
D. A single gene
B
17. The enzyme that “reads” the DNA sequence of a DNA strand and also adds security nucleotides to type a new strand of DNA is called:
A. RNA polymerase
B. DNA polymerase
C. DNA ligase
D. DNA exonuclease
B
18. One of the large surprises native the human Genome job was the the human being genome includes only 1.5% that __________________ DNA, while many of the genome (98.5%) has ____________________ DNA .
A. Coding, non-coding
B. Non-coding, coding
C. Complementary, non-complementary
D. Rough, smooth
A
1. I m sorry of the adhering to is not a nucleotide uncovered in DNA? a. A, adenine b. T, thymine c. C, cytosine d. G, guanine e. U, uracil
E
2. If the sequence of one strand that DNA is AGTCTAGC, what is the succession of the safety strand? a. AGTCTAGC b. CGATCTGA c. TCAGATCG d. GTCGACGC e. GCTAGACT
C
3. In enhancement to the base what space the other materials of a nucleotide? a. Sugar and also polymerase b. Phosphate and also sugar c. Phosphate and polymerase d. Phosphate and helix e. Helix and also sugar
B
6a. (true or false) G pairs v T
false
6b. (true or false) genetic information is happen on to the following generation in the kind of DNA molecules.
true
6c. (true or false) all DNA assignment encode details to develop proteins.
false
6d. (true or false) Each human being carries the same number of STR repeats on their maternal and paternal chromosomes.
See more: Address: Po Box 7241 Sioux Falls Sd With Reviews, Government Payment Solutions
false
6e. (true or false) DNA evidence can be acquired from saliva left in a bite mark.
true
9. Which mrs will have actually migrated farthest with an electrophoresis gel? a. (GAAG) recurring twice b. (GAAG) recurring three times c. (AGCT) repeated five times d. (GAAG) repetitive seven times e. (AGCT) repeated seven times
A
10. An individual"s STR may vary from the exact same STR of one more individual by virtue of… a. The order of nucleotides b. Which particular bases are present c. The specific chromosomal location of the str in each individual d. The number of times a certain sequence is recurring e. The number of coding regions
D
11. I m sorry of the following represents genetic variation between individuals? a. Even if it is or no G pairs v C or T b. The presence of both coding and also noncoding order in your genomes c. The number of chromosomes in the cell nucleus d. The sequence of nucleotides follow me the length of each chromosome e. The number of chromosomes received from each parent
D
14. The ____ chromosomes in a human cell from within the cheek are discovered in the _____. A. 46; cytoplasm b. 23; cell nucleus c. 24 cytoplasm d. 46, nucleus e. 22; nucleus
D
15. Each chromosome consists of a. DNA just b. Proteins just c. DNA and also proteins d. The same number of genes and STRs e. The whole genome the a cell
C
COMPANY
LEGAL & POLICIES
invernessgangshow.net PRODUCTS and SERVICES
invernessgangshow.net NETWORK
CUSTOMER SERVICE
